Category Archives: COPD

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: Conclusion

There are several limitations in our study. First, the age and smoking history in pack-years of the control group were not exactly equivalent to the COPD patient group. Considering that some sub jects in the control group might subsequently acquire COPD, with or without additional smoking exposure, the possibility remains that the different background of the two groups could influence the results of the genotyping. Ideally, the age and smoking history of the two groups should be exactly matched. Then the results of genotyping would be more clearly differentiated between the two groups. Secondly, only a small number of smoker control subjects were successfully followed up for > 1 year, and we obtained dFEV1 data in a segment of this group. This was because they stopped visiting the clinic on cessation of smoking. Thirdly, data on HRCT parameters were not collected in the healthy smoker group because the facilities where the healthy smokers were recruited were not equipped with the same imaging technique that was available for the patients with COPD. If healthy smokers with Gc*1F allele could be shown to have larger dFEV1 and higher LAA% than those without the allele, our conclusion that the Gc*1F allele is related to the development of COPD would be more clearly substantiated. The role of this allele in the early development of COPD remains to be investigated. buy prozac online

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: FEV1/FVC

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: FEV1/FVCPrevious studies have shown that LAA% and sCLA correlated well with FEV1 percentage predicted and FEV1/FVC. In HRCT examinations, patients with Gc*1F allele had a higher LAA%, lower mean CT score, and larger sCLA than patients without the allele, whereas no difference was observed in the baseline FEV1 percentage predicted. This result may suggest that patients with the Gc*1F allele tend to acquire a more severe emphysema than patients without the Gc*1F allele. There have been few attempts to define a correlation between genetic factors and emphysematous changes in HRCT. HRCT is less frequently used in clinical practice for the management of COPD than pulmonary function tests. We suppose the reason may be due to its higher cost and lack of feasibility of setting up the equipment. Further investigation is needed to clarify whether Gc-globulin polymorphism contributes to an early development of pathologic emphysematous lesions that are difficult to detect by pulmonary function tests. http://cheap-asthma-inhalers.com/

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele:

They concluded that the reason was due to the insufficient number of subjects needed to verify the hypothesis that Gc*1F homozygotes had an increased risk. These studies were based on white populations in which the frequencies of the three alleles were 0.16, 0.56, and 0.28 for Gc*1F, Gc*1S and Gc*2, respectively. It has been noted that the frequency of the Gc allele varies with ethnicity; in the Japanese population, it has been reported to be 0.49, 0.24, and 0.25 for Gc*1F, Gc*1S, and Gc*2, respectively. This distribution has a larger frequency of Gc*1F compared to that in whites. Our results and those of Ishii et al corroborate that Gc*1F homozygotes have an increased risk for COPD, at least in the Japanese population.

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: Discussion

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: DiscussionSimple linear regression analysis was used for studying correlations between LAA% and mean CT score. Mean CT score was linearly correlated with LAA% (R2 = 0.97, p < 0.001), with a simple linear regression model as follows: mean CT score (HU) = — 1.69 X LAA% — 842. Patients with mean CT score < — 940 HU were defined as having severe emphysema based on this model. Again, severely emphysematous patients with mean CT score < — 940 HU were more frequently seen in the Gc*1F( + ) group than in the Gc*1F( —) group (26 patients vs 0 patients, p < 0.0001; Fig 3). Additionally, sCLA was larger in Gc*1F( + ) patients than Gc*1F( —) patients (35.9 ± 26.2 pixels vs 22.7 ± 12.1 pixels, p = 0.004; Fig 4). There was no significant difference in total number of CLAs between the two groups (5,005 ± 2,117 vs 4,267 ± 2,135, p = 0.25). birth control pills

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: dFEV1

Follow-up pulmonary function data for calculating dFEV1 was available in 86 of the 103 patients with COPD, and 21 of the 88 smoker control subjects, There was no significant difference in age, smoking history, the baseline FEV1 percentage predicted, and the distributions of Gc-globulin allele between subjects with 1-year follow-up data and those without them in either patients with COPD or control subjects. The dFEV1 of patients with COPD (48.3 ± 62.7 mL) was significantly larger than that of control subjects (17.9 ± 32.5 mL, p < 0.0001). There were 17 RDs (20%) in the group of patients with COPD, whereas there were no RDs in the smoker control group (p = 0.03). There was no significant difference in dFEV1 between Gc*1F homozygotic patients and patients with other genotypes (54.9 ± 66.4 mLvs 45.5 ± 60.7 mL, p = 0.54); likewise, there was no significant difference in the frequency of RDs between the two groups (23% vs 20%, p = 0.78). In comparison of dFEV1 between patients with COPD and Gc*1F alleles [Gc*1F( + )] and patients with COPD without Gc*1F alleles [Gc*1F( —)], there were no significant differences in age, smoking history, and the baseline FEVX percentage predicted. However, the former group showed significantly larger dFEV1 than the latter group (53.8 ± 64.8 mL vs 20.2 ± 39.9 mL, p = 0.01). All of the 17 RDs were Gc*1F( + ) patients with COPD, and no RD was seen in Gc*1F( —) patients (p = 0.04). fully

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: Pulmonary Function Testing

Pulmonary function tests were performed at the initial visit, and at each of the follow-up visits. The initial test values were used as the baseline data. When follow-up data were available > 1 year after the initial test, dFEV1 was obtained by subtracting the last follow-up FEV1 value from the baseline FEV1 value, and dividing by the time in years between the two tests (milliliters per year). At each clinic, all the lung function measurements were performed with consistency using the same type of electrospirometer; the Autospiro AS-600 (Minato Medical Science; Osaka, Japan) was used at the COPD clinic, and Chestac-65V (Chest; Tokyo, Japan) was used at the smokers’ clinic. In patients with COPD, the measurements were performed in their stable state, ie, there were no exacerbations of the conditions from the preceding 6 weeks. The use of bronchodilators was prohibited for at least 12 h before the tests were performed. The predicted values for pulmonary function were calculated based on the formula proposed by the Japan Society of Chest Diseases. Based on the previous studies, subjects who had a dFEV1 > 90 mL were defined as rapid decliners (RDs). more

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: Statistical Analysis

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: Statistical AnalysisTo test Gc-globulin phenotypic variance between patients with COPD and healthy smokers, and to compare the frequency of individuals over or under the threshold (dFEV1 > 90 mL/yr, LAA% > 60%, or mean CT score < — 940 HU) in the two populations, asymptotic normal tests for the equality of two population probabilities were performed. A Welch test was employed to test the difference of population averages in continuous variates between the two groups. StatView Version 5.0 (SAS Institute; Cary, NC) was used for the statistical calculations; p < 0.05 was considered statistically significant. more

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: Genotyping

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: GenotypingDNA for genotyping was extracted from blood using standard phenolchloroform method. To detect point mutations in exon XI (Glu/Asp 416 and Thr/Lys 420) of the Gc-globulin gene, polymerase chain reaction (PCR) was performed followed by restriction fragment-length polymorphism analysis. To amplify the region of interest that contains the point mutations, we used the upstream primer described by Schellenberg et al (5’TAAT-GAGCAAATGAAAGAAG3′), and we designed a downstream primer (5’TGAGTAGATTGGAGTGCATAC3′) according to the published Gc-globulin gene sequence. The PCR product is a fragment of 462 base-pairs (bp). review

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: Materials and Methods

We also considered it important to test the contribution of Gc-globulin genotypes to the disease progression or severity in patients with COPD because, to our knowledge, this has not yet been investigated. The annual decline of FEV1 (dFEV1) is often taken to represent progressive airway obstruction and physiologic deterioration in smokers, and as an indication of disease progression in patients with COPD. Sandford et al investigated the relationship between various candidate gene genotypes, including Gc-globulin, and dFEV1 in a population of smokers; no relation was seen between Gc-globulin genotypes and decline in lung function. In addition to the evaluation of airway obstruction, it is also important to evaluate in patients with COPD the severity of parenchymal injury that is termed emphysema. Parameters such as low-attenuation area percentage (LAA%) and mean CT score in high-resolu-tion CT (HRCT) have been shown to be useful in the assessment of emphysema. To test the hypothesis that Gc-globulin polymorphism has an important role in the susceptibility to COPD, we analyzed the polymorphism in patients with COPD and healthy smokers in a sample drawn from the Japanese population. We further examined the correlation between the genotypes and the extent of deterioration in the rate of airflow in patients with COPD represented by dFEV1. The correlation between the genotypes and the extent of emphysema was evaluated by several radiologic parameters assessed by HRCT.

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F AlleleAlthough the most critical factor for acquiring COPD is cigarette smoking, only 15 to 20% of chronic smokers get this disease. Several epidemiologic studies have suggested familial clustering of the disease. This suggests that the genetic factors are likely to have a role in determining an individual’s susceptibility to COPD. Polymorphisms of several candidate genes have been investigated in relation to the development of COPD. One such candidate is the gene encoding the group-specific component of serum globulin (Gc-globulin), also called vitamin-D-binding protein.

Pages: 1 2 3 Next