Loading

wait a moment

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: Genotyping

Risk and Severity of COPD Is Associated With the Group-Specific Component of Serum Globulin 1F Allele: GenotypingDNA for genotyping was extracted from blood using standard phenolchloroform method. To detect point mutations in exon XI (Glu/Asp 416 and Thr/Lys 420) of the Gc-globulin gene, polymerase chain reaction (PCR) was performed followed by restriction fragment-length polymorphism analysis. To amplify the region of interest that contains the point mutations, we used the upstream primer described by Schellenberg et al (5’TAAT-GAGCAAATGAAAGAAG3′), and we designed a downstream primer (5’TGAGTAGATTGGAGTGCATAC3′) according to the published Gc-globulin gene sequence. The PCR product is a fragment of 462 base-pairs (bp). review

PCR was carried out with a thermal cycler (DNA Thermal Cycler; Perkin Elmer Cetus; Norwalk, CT). One hundred nanograms of genomic DNA was added to a mixture containing the following: 0.5 |j,mo]/L of each primer; 3.75 U of Taq DNA polymerase (AmpliTaq DNA Polymerase; Roche; Basel, Switzerland); 0.2 mM each of deoxyadenosine triphosphate, deoxycita-dine triphosphate, deoxyguanosine triphosphate, and deoxythy-midine triphosphate (Amersham Biosciences KK; Tokyo, Japan); 1.5 mM MgCl2; and 10 mM Tris Cl (pH 8.3) in a final volume of 150 |j,L. For amplification, the cycling parameters were 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s, for 35 cycles. The PCR products were digested separately with restriction enzymes Hae III (Toyobo; Osaka, Japan) or Eco T14 I restriction enzymes (Takara Bio; Otsu, Japan) at 37°C overnight. Hae III cuts the Gc*1S allele at the point including the mutation Glu (GGT, Gc*1S) з Asp (TGC, Gc*1F or Gc*2) into two bands of 295 bp and 167 bp, whereas Eco T14 I cuts Gc*2 allele into two bands of 302 bp and 156 bp including the mutation Thr (ACG, Gc*1F or Gc*1S) з Lys (AAG, Gc*2). Therefore, the PCR product from Gc*1F homozygotes alone remains uncut by either of the enzymes. The digested fragments were resolved on 3% agarose gels, stained with ethidium bromide (Invitrogen; Carlsbad, CA), and observed under ultraviolet light (Fig 1).
Fig1
Figure 1. Restriction fragment-length polymorphism analysis of Gc-globulin genotypes. All six genotypes are shown. E: digested with Eco T14 I. H: digested with Hae III. M: 100-1, 500-bp DNA ladder. 1F: Gc*1F, 1S: Gc*1S, 2: Gc*2. Fragments in lane E (302 bp and 156 bp) indicate a Gc*2 allele, whereas an intact band in lane E (462 bp) indicates the presence of either a Gc*1F or Gc*1S allele. Fragments in lane H (295 bp and 167 bp) indicate a Gc*1S allele, whereas an intact band in lane H (462 bp) indicates the presence of either a Gc*1F or Gc*2 allele.